Stem-loop sequence mdo-mir-7315

AccessionMI0023839 (change log)
DescriptionMonodelphis domestica miR-7315 stem-loop
Stem-loop
   --g               a        ucc 
5'    uggguuagaagaucu gguuggaa   c
      ||||||||||||||| ||||||||   a
3'    acccaaucuucuaga ccaaccuu   a
   gua               c        cac 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 139836231-139836291 [+]
intergenic
Database links

Mature sequence mdo-miR-7315-5p

Accession MIMAT0028630
Sequence

1 - 

guggguuagaagaucuagguug

 - 22

Get sequence
Deep sequencing36 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7315-3p

Accession MIMAT0028631
Sequence

40 - 

acccagaucuucuaacccaaug

 - 61

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).