Stem-loop sequence mdo-mir-7313

AccessionMI0023837 (change log)
DescriptionMonodelphis domestica miR-7313 stem-loop
Stem-loop
   ga      uau    -     c  agaac 
5'   aauccg   accu uucag ug     a
     ||||||   |||| ||||| ||      
3'   uuaggc   ugga aaguc ac     u
   cc      cuu    c     a  aagaa 
Get sequence
Deep sequencing
7433 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 80422358-80422416 [-]
intergenic
Database links

Mature sequence mdo-miR-7313-5p

Accession MIMAT0028626
Sequence

1 - 

gaaauccguauaccuuucagcug

 - 23

Get sequence
Deep sequencing295 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7313-3p

Accession MIMAT0028627
Sequence

38 - 

acugaacagguuuccggauucc

 - 59

Get sequence
Deep sequencing7138 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).