Stem-loop sequence mdo-mir-7312

AccessionMI0023836 (change log)
DescriptionMonodelphis domestica miR-7312 stem-loop
Stem-loop
   --                       cuu 
5'   aaagauauauugcagaggguguu   u
     |||||||||||||||||||||||    
3'   uuucuauauaacgucuccuacag   c
   ac                       uua 
Get sequence
Deep sequencing
2509 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 17899131-17899186 [-]
sense
Clustered miRNAs
< 10kb from mdo-mir-7312
mdo-mir-7312bchr4: 17899133-17899188 [+]
mdo-mir-7312chr4: 17899131-17899186 [-]
Database links

Mature sequence mdo-miR-7312-5p

Accession MIMAT0028624
Sequence

1 - 

aaagauauauugcagagggugu

 - 22

Get sequence
Deep sequencing1616 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7312-3p

Accession MIMAT0028625
Sequence

35 - 

auccucugcaauauaucuuuca

 - 56

Get sequence
Deep sequencing892 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).