Stem-loop sequence mdo-mir-30c-2

AccessionMI0023835 (change log)
DescriptionMonodelphis domestica miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u       u   aca         ---g  a 
5'    guaaaca ccu   cucucagcu    ug g
      ||||||| |||   |||||||||    ||  
3'    cauuugu ggg   gagggucgg    ac c
   ccu       c   --a         ugga  u 
Get sequence
Deep sequencing
140682 reads, 1.94e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 424723799-424723859 [+]
sense
ENSMODT00000040383 ; mdo-mir-30c-2-201; exon 1
ENSMODT00000022319 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from mdo-mir-30c-2
mdo-mir-30dchr4: 424720167-424720230 [+]
mdo-mir-30c-2chr4: 424723799-424723859 [+]
Database links

Mature sequence mdo-miR-30c-5p

Accession MIMAT0028502
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Deep sequencing240391 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-30c-2-3p

Accession MIMAT0031090
Sequence

41 - 

ugggagagggcuguuuacucc

 - 61

Get sequence
Deep sequencing20485 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).