Stem-loop sequence mdo-mir-30d

AccessionMI0023834 (change log)
DescriptionMonodelphis domestica miR-30d stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --           uu           g aaggu 
5'   uguaaacaucc  gacuggaagcu u     g
     |||||||||||  ||||||||||| |      
3'   acauuuguagg  cugacuuucga g     c
   cg           --           g agguu 
Get sequence
Deep sequencing
3833503 reads, 6.17e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 424720167-424720230 [+]
sense
ENSMODT00000040378 ; mdo-mir-30d-201; exon 1
ENSMODT00000022319 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from mdo-mir-30d
mdo-mir-30dchr4: 424720167-424720230 [+]
mdo-mir-30c-2chr4: 424723799-424723859 [+]
Database links

Mature sequence mdo-miR-30d-5p

Accession MIMAT0028622
Sequence

1 - 

uguaaacauccuugacuggaagc

 - 23

Get sequence
Deep sequencing3498709 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-30d-3p

Accession MIMAT0028623
Sequence

44 - 

uuucagucggauguuuacagc

 - 64

Get sequence
Deep sequencing334673 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).