Stem-loop sequence mdo-mir-7310

AccessionMI0023832 (change log)
DescriptionMonodelphis domestica miR-7310 stem-loop
Stem-loop
   --           --   a     a  aaau 
5'   ccuaauccaga  aug gggug gu    u
     |||||||||||  ||| ||||| ||     
3'   ggauuagguuu  uac ccuac ca    g
   gu           au   g     -  aaga 
Get sequence
Deep sequencing
7269 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 368329507-368329565 [+]
sense
ENSMODT00000014078 ; EPB41-201; intron 15
antisense
ENSMODT00000043637 ; SRSF4-201; intron 6
Database links

Mature sequence mdo-miR-7310-5p

Accession MIMAT0028618
Sequence

1 - 

ccuaauccagaaugagggug

 - 20

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7310-3p

Accession MIMAT0028619
Sequence

38 - 

uccgcauuauuuggauuaggug

 - 59

Get sequence
Deep sequencing7268 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).