Stem-loop sequence mdo-mir-7309

AccessionMI0023831 (change log)
DescriptionMonodelphis domestica miR-7309 stem-loop
Stem-loop
   --a    u       u  guc    u  uc 
5'    ggga ggggagc ca   agug gu  c
      |||| ||||||| ||   |||| ||   
3'    cucu ccccuug gu   ucac ua  u
   gga    c       u  aac    u  cc 
Get sequence
Deep sequencing
7604 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 362633939-362633998 [+]
sense
ENSMODT00000033770 ; MAN1C1-201; intron 1
Database links

Mature sequence mdo-miR-7309-5p

Accession MIMAT0028616
Sequence

1 - 

agggauggggagcucagucagu

 - 22

Get sequence
Deep sequencing198 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7309-3p

Accession MIMAT0028617
Sequence

39 - 

ucaauguguucccccucucagg

 - 60

Get sequence
Deep sequencing7406 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).