Stem-loop sequence mdo-mir-7308

AccessionMI0023830 (change log)
DescriptionMonodelphis domestica miR-7308 stem-loop
Stem-loop
   ugu    ---ca        a     - a  a 
5'    gcga     cuggucag gauua c ca u
      ||||     |||||||| ||||| | || c
3'    cguu     gaccgguu cuaau g gu a
   --c    ccuaa        c     c a  u 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 328235628-328235688 [+]
sense
Database links

Mature sequence mdo-miR-7308-5p

Accession MIMAT0028614
Sequence

1 - 

ugugcgacacuggucagagauu

 - 22

Get sequence
Deep sequencing24 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7308-3p

Accession MIMAT0028615
Sequence

41 - 

uccuuggccagaauccuugcc

 - 61

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).