Stem-loop sequence mdo-mir-208b

AccessionMI0023829 (change log)
DescriptionMonodelphis domestica miR-208b stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
   --          c   gg        ug 
5'   aagcuuuuug ucg  uuauguuu  g
     |||||||||| |||  ||||||||  a
3'   uuuggaaaac agc  aauauaag  u
   ug          a   ag        uc 
Get sequence
Deep sequencing
1507 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 172843322-172843378 [-]
sense
ENSMODT00000040650 ; mdo-mir-208b-201; exon 1
ENSMODT00000005567 ; MYH7-201; intron 29
Database links

Mature sequence mdo-miR-208b-5p

Accession MIMAT0028612
Sequence

1 - 

aagcuuuuugcucggguuaugu

 - 22

Get sequence
Deep sequencing837 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-208b-3p

Accession MIMAT0028613
Sequence

36 - 

auaagacgaacaaaagguuugu

 - 57

Get sequence
Deep sequencing667 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).