Stem-loop sequence mdo-mir-7307

AccessionMI0023828 (change log)
DescriptionMonodelphis domestica miR-7307 stem-loop
Stem-loop
   --        -u  c  -uc    -------    a 
5'   aguucaga  ug cc   uggg       gaug a
     ||||||||  || ||   ||||       |||| a
3'   ucgagucu  ac gg   accc       cuac a
   uu        uu  u  uaa    aaagaau    a 
Get sequence
Deep sequencing
1191 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 183248459-183248522 [+]
intergenic
Database links

Mature sequence mdo-miR-7307-5p

Accession MIMAT0028610
Sequence

1 - 

aguucagauugcccucuggg

 - 20

Get sequence
Deep sequencing665 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7307-3p

Accession MIMAT0028611
Sequence

43 - 

caaauggucauuucugagcuuu

 - 64

Get sequence
Deep sequencing526 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).