Stem-loop sequence mdo-mir-7306

AccessionMI0023826 (change log)
DescriptionMonodelphis domestica miR-7306 stem-loop
Stem-loop
   --au           u    a    g   u c g  u 
5'     gggggcaggau gguc ggag ugg g u ac a
       ||||||||||| |||| |||| ||| | | || g
3'     ccucuguucug ccgg ccuc acc c a ug g
   ugau           u    -    a   - c g  u 
Get sequence
Deep sequencing
172 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 412917178-412917250 [-]
sense
ENSMODT00000017389 ; FCGRT-201; intron 7
antisense
ENSMODT00000017341 ; RRAS-201; intron 2
ENSMODT00000031346 ; AKT1S1-201; intron 4
ENSMODT00000031329 ; mdo-mir-7306-201; exon 6
ENSMODT00000017331 ; mdo-mir-7306-202; exon 8
Database links

Mature sequence mdo-miR-7306-5p

Accession MIMAT0028606
Sequence

1 - 

augggggcaggauuggucaggagg

 - 24

Get sequence
Deep sequencing44 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7306-3p

Accession MIMAT0028607
Sequence

51 - 

uccggccugucuugucuccuagu

 - 73

Get sequence
Deep sequencing128 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).