Stem-loop sequence mdo-mir-7303

AccessionMI0023823 (change log)
DescriptionMonodelphis domestica miR-7303 stem-loop
Stem-loop
   --          u      a  c   ---g  a 
5'   acauccaaac ggacgc cu ucu    gu c
     |||||||||| |||||| || |||    || a
3'   uguggguuug ucugcg ga gga    cg a
   ag          u      -  c   agca  a 
Get sequence
Deep sequencing
2386 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 400890972-400891034 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7303
mdo-mir-7305chr4: 400892027-400892085 [-]
mdo-mir-7304chr4: 400891596-400891650 [-]
mdo-mir-1541chr4: 400891414-400891481 [-]
mdo-mir-7303chr4: 400890972-400891034 [-]
mdo-mir-1643bchr4: 400890701-400890759 [-]
mdo-mir-7302chr4: 400890546-400890607 [-]
mdo-mir-1643achr4: 400890413-400890471 [-]
Database links

Mature sequence mdo-miR-7303-5p

Accession MIMAT0028600
Sequence

1 - 

acauccaaacuggacgcacucuc

 - 23

Get sequence
Deep sequencing41 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7303-3p

Accession MIMAT0028601
Sequence

42 - 

caggcgucuuguuuggguguga

 - 63

Get sequence
Deep sequencing2345 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).