Stem-loop sequence mdo-mir-7300

AccessionMI0023818 (change log)
DescriptionMonodelphis domestica miR-7300 stem-loop
Stem-loop
   --               ag     -  gga 
5'   gacuccaauauccua  gauau ug   u
     |||||||||||||||  ||||| ||    
3'   cugagguuauaggau  cuaua ac   u
   uu               -a     u  aua 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 362166097-362166154 [-]
sense
Database links

Mature sequence mdo-miR-7300-5p

Accession MIMAT0028592
Sequence

1 - 

gacuccaauauccuaaggaua

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7300-3p

Accession MIMAT0028593
Sequence

39 - 

ucauaggauauuggagucuu

 - 58

Get sequence
Deep sequencing84 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).