Stem-loop sequence mdo-mir-34c

AccessionMI0023815 (change log)
DescriptionMonodelphis domestica miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --a   a    a     c      cua  a 
5'    ggc gugu guuag ugauug   gc g
      ||| |||| ||||| ||||||   ||  
3'    ccg caca caauc acuaac   ug u
   gaa   a    c     -      -ca  a 
Get sequence
Deep sequencing
829913 reads, 3.45e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 241888509-241888566 [-]
sense
ENSMODT00000028234 ; mdo-mir-34c-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-34c
mdo-mir-34bchr4: 241889198-241889256 [-]
mdo-mir-34dchr4: 241889198-241889260 [+]
mdo-mir-34cchr4: 241888509-241888566 [-]
Database links

Mature sequence mdo-miR-34c-5p

Accession MIMAT0028586
Sequence

1 - 

aggcaguguaguuagcugauugc

 - 23

Get sequence
Deep sequencing828557 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-34c-3p

Accession MIMAT0028587
Sequence

37 - 

aaucacuaaccacacagccaag

 - 58

Get sequence
Deep sequencing1356 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).