Stem-loop sequence mdo-mir-7298

AccessionMI0023814 (change log)
DescriptionMonodelphis domestica miR-7298 stem-loop
Stem-loop
   --   a                 -  uuu 
5'   uca guuaagcuucaagccag ug   a
     ||| ||||||||||||||||| ||    
3'   ggu caauucgaaguucgguc ac   c
   ag   a                 c  uca 
Get sequence
Deep sequencing
179 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 17940149-17940205 [-]
sense
ENSMODT00000024755 ; PPAP2A-201; intron 1
Database links

Mature sequence mdo-miR-7298-5p

Accession MIMAT0028584
Sequence

1 - 

ucaaguuaagcuucaagccagu

 - 22

Get sequence
Deep sequencing154 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7298-3p

Accession MIMAT0028585
Sequence

36 - 

uggcuugaagcuuaacauggga

 - 57

Get sequence
Deep sequencing25 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).