Stem-loop sequence mdo-mir-449b

AccessionMI0023813 (change log)
DescriptionMonodelphis domestica miR-449b stem-loop
Stem-loop
   -ua     u c  u  aag         uggc 
5'    ggcag g gc gu   cuggcugcu    u
      ||||| | || ||   |||||||||    c
3'    ccguc c cg ca   gacugacga    a
   uca     - -  u  --g         uuua 
Get sequence
Deep sequencing
209 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 17545755-17545816 [-]
sense
ENSMODT00000024729 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-449b
mdo-mir-449bchr3: 17545755-17545816 [-]
mdo-mir-449achr3: 17545606-17545684 [-]
mdo-mir-449cchr3: 17544592-17544650 [-]
Database links

Mature sequence mdo-miR-449b-5p

Accession MIMAT0028582
Sequence

1 - 

uaggcagugcgcuguaagcuggcugcu

 - 27

Get sequence
Deep sequencing115 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-449b-3p

Accession MIMAT0028583
Sequence

41 - 

cagucaggacugcccugccacu

 - 62

Get sequence
Deep sequencing92 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).