Stem-loop sequence mdo-mir-449c

AccessionMI0023812 (change log)
DescriptionMonodelphis domestica miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   --   c       u  u    a     uuuu 
5'   ggg aguguau gu aguu gcugu    c
     ||| ||||||| || |||| |||||    a
3'   ccu ucacaua cg ucaa cgacg    u
   ua   -       -  -    -     ugaa 
Get sequence
Deep sequencing
1655 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 17544592-17544650 [-]
sense
ENSMODT00000024729 ; CDC20B-201; intron 2
antisense
ENSMODT00000024730 ; mdo-mir-449c-201; exon 3
Clustered miRNAs
< 10kb from mdo-mir-449c
mdo-mir-449bchr3: 17545755-17545816 [-]
mdo-mir-449achr3: 17545606-17545684 [-]
mdo-mir-449cchr3: 17544592-17544650 [-]
Database links

Mature sequence mdo-miR-449c-5p

Accession MIMAT0028580
Sequence

1 - 

gggcaguguauuguuaguuag

 - 21

Get sequence
Deep sequencing1594 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-449c-3p

Accession MIMAT0028581
Sequence

42 - 

aacugcauacacuuccau

 - 59

Get sequence
Deep sequencing61 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).