Stem-loop sequence mdo-mir-7297

AccessionMI0023811 (change log)
DescriptionMonodelphis domestica miR-7297 stem-loop
Stem-loop
   uu      u         g      a   ac 
5'   ugcuuc ccuuuccuu ugcuuc uuu  u
     |||||| ||||||||| |||||| |||   
3'   augagg gggaaggaa acggag aag  u
   gu      -         -      -   gu 
Get sequence
Deep sequencing
2207 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 498005958-498006018 [+]
sense
ENSMODT00000013414 ; ADRBK2-201; intron 7
Database links

Mature sequence mdo-miR-7297-5p

Accession MIMAT0028578
Sequence

1 - 

uuugcuucuccuuuccuugugcu

 - 23

Get sequence
Deep sequencing2205 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7297-3p

Accession MIMAT0028579
Sequence

43 - 

caaaggaagggggaguaug

 - 61

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).