Stem-loop sequence mdo-mir-7296

AccessionMI0023810 (change log)
DescriptionMonodelphis domestica miR-7296 stem-loop
Stem-loop
   --          g cu        uuuuguuc 
5'   gaaguuuuag g  gucuuaag        a
     |||||||||| |  ||||||||         
3'   uuucagaauc c  uagaauuc        u
   gg          a ag        uauuauuu 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 122600868-122600931 [-]
intergenic
Database links

Mature sequence mdo-miR-7296-5p

Accession MIMAT0028576
Sequence

1 - 

gaaguuuuagggcugucuuaag

 - 22

Get sequence
Deep sequencing31 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7296-3p

Accession MIMAT0028577
Sequence

43 - 

uaagaugacacuaagacuuugg

 - 64

Get sequence
Deep sequencing98 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).