Stem-loop sequence mdo-mir-7295

AccessionMI0023809 (change log)
DescriptionMonodelphis domestica miR-7295 stem-loop
Stem-loop
   --ac    -acc   -     a   gc 
5'     cgcc    acc ugcag gcu  c
       ||||    ||| ||||| |||  u
3'     gcgg    ugg gcguc cga  c
   cgaa    gcau   c     c   ag 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 481242206-481242258 [+]
sense
ENSMODT00000019213 ; mdo-mir-7295-202; 3'UTR (exon 9)
ENSMODT00000033278 ; mdo-mir-7295-201; 3'UTR (exon 10)
Database links

Mature sequence mdo-miR-7295-5p

Accession MIMAT0028574
Sequence

1 - 

accgccaccaccugcagagcu

 - 21

Get sequence
Deep sequencing76 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7295-3p

Accession MIMAT0028575
Sequence

31 - 

cccugcgcgguuacgggcgaagc

 - 53

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).