Stem-loop sequence mdo-mir-7294

AccessionMI0023808 (change log)
DescriptionMonodelphis domestica miR-7294 stem-loop
Stem-loop
   ----u       caaca     a  u    a 
5'      cuugaag     guuac ag aaac u
        |||||||     ||||| || |||| g
3'      gaacuuc     caaug uc uuug u
   acggu       -aaag     a  c    u 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 447750034-447750093 [+]
intergenic
Database links

Mature sequence mdo-miR-7294-5p

Accession MIMAT0028572
Sequence

1 - 

ucuugaagcaacaguuacaagu

 - 22

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7294-3p

Accession MIMAT0028573
Sequence

38 - 

uaguaacgaaacuucaaguggca

 - 60

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).