Stem-loop sequence mdo-mir-199b-3

AccessionMI0023807 (change log)
DescriptionMonodelphis domestica miR-199b-3 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --       u        c   c  ggagau 
5'   ccagugu cagacuac ugu ca      u
     ||||||| |||||||| ||| ||       
3'   gguuaca gucugaug aca gu      g
   uu       c        -   u  ggaaac 
Get sequence
Deep sequencing
34841 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 430288134-430288194 [+]
sense
ENSMODT00000040278 ; mdo-mir-199b-3-201; exon 1
antisense
ENSMODT00000007667 ; DNM2-201; intron 15
Database links

Mature sequence mdo-miR-199b-3-5p

Accession MIMAT0031066
Sequence

1 - 

ccaguguucagacuaccugucc

 - 22

Get sequence
Deep sequencing57 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-199b-3p

Accession MIMAT0026678
Sequence

41 - 

acaguagucugcacauugguu

 - 61

Get sequence
Deep sequencing110089 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).