Stem-loop sequence mdo-mir-7293

AccessionMI0023806 (change log)
DescriptionMonodelphis domestica miR-7293 stem-loop
Stem-loop
   --a        g       u  ca  ggu 
5'    gcagaaau ccccagc cc  gu   a
      |||||||| ||||||| ||  ||    
3'    cgucuuua ggggucg gg  ca   a
   cac        a       c  -a  gau 
Get sequence
Deep sequencing
11844 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 362140420-362140476 [+]
intergenic
Database links

Mature sequence mdo-miR-7293-5p

Accession MIMAT0028570
Sequence

1 - 

agcagaaaugccccagcuccc

 - 21

Get sequence
Deep sequencing51 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7293-3p

Accession MIMAT0028571
Sequence

37 - 

gcgcuggggaauuucugccac

 - 57

Get sequence
Deep sequencing11793 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).