Stem-loop sequence mdo-mir-7292

AccessionMI0023805 (change log)
DescriptionMonodelphis domestica miR-7292 stem-loop
Stem-loop
   --        gc   a  uuca   uu     u 
5'   aaggaagg  cuc cu    agc  cuaua c
     ||||||||  ||| ||    |||  |||||  
3'   uuccuucc  gag ga    ucg  gaugu c
   uc        uu   -  ----   uc     u 
Get sequence
Deep sequencing
1040 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 118003105-118003165 [-]
sense
ENSMODT00000024635 ; ABHD17C-201; intron 4
Database links

Mature sequence mdo-miR-7292-5p

Accession MIMAT0028568
Sequence

1 - 

aaggaagggccucacuuucaagcuucu

 - 27

Get sequence
Deep sequencing576 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7292-3p

Accession MIMAT0028569
Sequence

40 - 

cugcuaggaguuccuuccuucu

 - 61

Get sequence
Deep sequencing464 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).