Stem-loop sequence mdo-mir-7291

AccessionMI0023804 (change log)
DescriptionMonodelphis domestica miR-7291 stem-loop
Stem-loop
   --    g  cuc          --  ugc 
5'   ugug cu   ccugugaaga  ga   u
     |||| ||   ||||||||||  ||    
3'   acac ga   ggacacuucu  cu   a
   ag    g  ccu          ac  uag 
Get sequence
Deep sequencing
207 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 514100646-514100701 [-]
sense
ENSMODT00000031717 ; DGCR2-201; intron 6
Database links

Mature sequence mdo-miR-7291-5p

Accession MIMAT0028566
Sequence

1 - 

uguggcucucccugugaagaga

 - 22

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7291-3p

Accession MIMAT0028567
Sequence

35 - 

ucuucacagguccaggcacaga

 - 56

Get sequence
Deep sequencing196 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).