Stem-loop sequence mdo-mir-130c-2

AccessionMI0023803 (change log)
DescriptionMonodelphis domestica miR-130c-2 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   --        cu      c     gag  a 
5'   gcccuuuu  uguugc cugcu   cc g
     ||||||||  |||||| |||||   || c
3'   cgggaaaa  guaacg gacgg   gg g
   ua        uu      u     --g  a 
Get sequence
Deep sequencing
12524 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 511102163-511102221 [-]
sense
ENSMODT00000040269 ; mdo-mir-130c-2-201; exon 1
antisense
ENSMODT00000022456 ; mdo-mir-130b-201; exon 3
Clustered miRNAs
< 10kb from mdo-mir-130c-2
mdo-mir-130c-2chr3: 511102163-511102221 [-]
mdo-mir-130bchr3: 511101361-511101418 [-]
Database links

Mature sequence mdo-miR-130c-2-5p

Accession MIMAT0031110
Sequence

1 - 

gcccuuuucuuguugcccugcu

 - 22

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-130c-3p

Accession MIMAT0028515
Sequence

38 - 

cagugcaauguuaaaagggcau

 - 59

Get sequence
Deep sequencing25036 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).