Stem-loop sequence mdo-mir-130b

AccessionMI0023802 (change log)
DescriptionMonodelphis domestica miR-130b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   --        c u     c      ucc    
5'   gcucuuuc c guugc cugcug   ggu 
     |||||||| | ||||| ||||||   || c
3'   cgggaaag g uaacg gacgau   cca 
   ua        u u     u      ---    
Get sequence
Deep sequencing
6123 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 511101361-511101418 [-]
sense
ENSMODT00000040397 ; mdo-mir-130b-201; exon 1
antisense
ENSMODT00000022456 ; mdo-mir-130b-201; exon 3
Clustered miRNAs
< 10kb from mdo-mir-130b
mdo-mir-130c-2chr3: 511102163-511102221 [-]
mdo-mir-130bchr3: 511101361-511101418 [-]
Database links

Mature sequence mdo-miR-130b-5p

Accession MIMAT0028564
Sequence

1 - 

gcucuuucccuguugcccugcu

 - 22

Get sequence
Deep sequencing52 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-130b-3p

Accession MIMAT0028565
Sequence

37 - 

cagugcaauugugaaagggcau

 - 58

Get sequence
Deep sequencing6071 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).