Stem-loop sequence mdo-mir-7290

AccessionMI0023801 (change log)
DescriptionMonodelphis domestica miR-7290 stem-loop
Stem-loop
   --          uu g      ag  aua 
5'   ucuggcucug  u cagcgc  ug   u
     ||||||||||  | ||||||  ||    
3'   agaccgagau  a gucgcg  ac   u
   ac          uc g      aa  agg 
Get sequence
Deep sequencing
35451 reads, 440 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 506150237-506150294 [-]
intergenic
Database links

Mature sequence mdo-miR-7290-5p

Accession MIMAT0028562
Sequence

1 - 

ucuggcucuguuugcagcgc

 - 20

Get sequence
Deep sequencing35399 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7290-3p

Accession MIMAT0028563
Sequence

39 - 

gcuggacuuagagccagaca

 - 58

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).