Stem-loop sequence mdo-mir-7289

AccessionMI0023800 (change log)
DescriptionMonodelphis domestica miR-7289 stem-loop
Stem-loop
   --u                a    -ca  a 
5'    gagcagcuggugggcu ugag   ga g
      |||||||||||||||| ||||   ||  
3'    uucgucgaccacccga acuc   cu u
   ugg                c    aaa  g 
Get sequence
Deep sequencing
7342 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 484373842-484373900 [-]
sense
ENSMODT00000014923 ; IFT81-201; intron 15
Database links

Mature sequence mdo-miR-7289-5p

Accession MIMAT0028560
Sequence

1 - 

ugagcagcuggugggcuaugag

 - 22

Get sequence
Deep sequencing6955 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7289-3p

Accession MIMAT0028561
Sequence

38 - 

cacagcccaccagcugcuuggu

 - 59

Get sequence
Deep sequencing387 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).