Stem-loop sequence mdo-mir-7288

AccessionMI0023799 (change log)
DescriptionMonodelphis domestica miR-7288 stem-loop
Stem-loop
   ug    -  c   c       ga   ggaa 
5'   uugg ua ugg uguggug  ccu    u
     |||| || ||| |||||||  |||     
3'   gacc au acc gcaccac  gga    a
   -u    u  a   c       ug   gaug 
Get sequence
Deep sequencing
11321 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 465007920-465007979 [-]
intergenic
Database links

Mature sequence mdo-miR-7288-5p

Accession MIMAT0028558
Sequence

1 - 

uguugguacuggcugugguggac

 - 23

Get sequence
Deep sequencing4001 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7288-3p

Accession MIMAT0028559
Sequence

40 - 

ucaccacgcccaauauccagu

 - 60

Get sequence
Deep sequencing7319 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).