Stem-loop sequence mdo-mir-7287

AccessionMI0023798 (change log)
DescriptionMonodelphis domestica miR-7287 stem-loop
Stem-loop
   --uaua        g u      c   ga  uc 
5'       aagggcua c caggga ccu  gu  c
         |||||||| | |||||| |||  ||  c
3'       uucccggu g gucccu gga  ca  u
   guuaga        a u      a   ac  uc 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 457792410-457792476 [-]
sense
ENSMODT00000007062 ; ABCA7-201; exon 28
Database links

Mature sequence mdo-miR-7287-5p

Accession MIMAT0028556
Sequence

1 - 

uauaaagggcuagcucagggac

 - 22

Get sequence
Deep sequencing83 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7287-3p

Accession MIMAT0028557
Sequence

46 - 

cccugugauggcccuuagauug

 - 67

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).