Stem-loop sequence mdo-mir-9b

AccessionMI0023797 (change log)
DescriptionMonodelphis domestica miR-9b stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc       uc      g     gug    
5'     uuugguu  cuagcu uguga   ucu 
       |||||||  |||||| |||||   || c
3'     aagccaa  ggucga auacu   agu 
   gugu       ga      a     --a    
Get sequence
Deep sequencing
2021 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 452650307-452650365 [-]
sense
ENSMODT00000040373 ; mdo-mir-9b-201; exon 1
Database links

Mature sequence mdo-miR-9b-5p

Accession MIMAT0028554
Sequence

1 - 

ucuuugguuuccuagcugugug

 - 22

Get sequence
Deep sequencing1364 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-9b-3p

Accession MIMAT0028555
Sequence

38 - 

uaaagcuggagaaccgaaugug

 - 59

Get sequence
Deep sequencing656 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).