Stem-loop sequence mdo-mir-181b-3

AccessionMI0023796 (change log)
DescriptionMonodelphis domestica miR-181b-3 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --a        ug             gugagau 
5'    acauucau  cugucgguggguu       c
      ||||||||  |||||||||||||        
3'    uguaagua  gguagccacucaa       u
   cac        --             aaaggag 
Get sequence
Deep sequencing
200541 reads, 3.06e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 446461129-446461192 [-]
sense
ENSMODT00000040288 ; mdo-mir-181b-3-201; exon 1
antisense
ENSMODT00000015282 ; PODNL1-201; intron 11
Clustered miRNAs
< 10kb from mdo-mir-181b-3
mdo-mir-181a-3chr3: 446461502-446461573 [-]
mdo-mir-181b-3chr3: 446461129-446461192 [-]
Database links

Mature sequence mdo-miR-181b-5p

Accession MIMAT0004155
Sequence

1 - 

aacauucauugcugucggugggu

 - 23

Get sequence
Deep sequencing599624 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181b-3-3p

Accession MIMAT0031048
Sequence

44 - 

ucaccgauggaugaaugucac

 - 64

Get sequence
Deep sequencing4752 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).