Stem-loop sequence mdo-mir-137b

AccessionMI0023795 (change log)
DescriptionMonodelphis domestica miR-137b stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   --   g       ug     a     c aa 
5'   acg guauucu  gguag uaaua c  u
     ||| |||||||  ||||| ||||| |   
3'   ugc cauaaga  ucguu auugu g  g
   ga   a       gu     -     c cg 
Get sequence
Deep sequencing
48905 reads, 1.13e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 429645670-429645728 [-]
sense
ENSMODT00000040398 ; mdo-mir-137b-201; exon 1
Database links

Mature sequence mdo-miR-137b-5p

Accession MIMAT0028552
Sequence

1 - 

acggguauucuuggguagauaaua

 - 24

Get sequence
Deep sequencing161 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-137b-3p

Accession MIMAT0028553
Sequence

37 - 

uuauugcuugagaauacacguag

 - 59

Get sequence
Deep sequencing48744 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).