Stem-loop sequence mdo-mir-30b

AccessionMI0023794 (change log)
DescriptionMonodelphis domestica miR-30b stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u          u  -a        uaa a 
5'    guaaacaucc ac  cucagcug   c c
      |||||||||| ||  ||||||||   |  
3'    cauuuguagg ug  gggucggc   g a
   cuu          -  ga        uag u 
Get sequence
Deep sequencing
13917 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 414604734-414604793 [-]
sense
ENSMODT00000040406 ; mdo-mir-30b-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-30b
mdo-mir-30echr3: 414610855-414610917 [-]
mdo-mir-30bchr3: 414604734-414604793 [-]
Database links

Mature sequence mdo-miR-30b-5p

Accession MIMAT0028550
Sequence

1 - 

uguaaacauccuacacucagcu

 - 22

Get sequence
Deep sequencing13778 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-30b-3p

Accession MIMAT0028551
Sequence

39 - 

cugggagguggauguuuacuuc

 - 60

Get sequence
Deep sequencing113 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).