Stem-loop sequence mdo-mir-7285

AccessionMI0023792 (change log)
DescriptionMonodelphis domestica miR-7285 stem-loop
Stem-loop
   --  a      c       a     ua aa 
5'   ag ggaacc cugauuu uuugg  g  u
     || |||||| ||||||| |||||  |   
3'   uc ccuugg gacugaa gaacu  u  c
   au  c      c       c     gg cc 
Get sequence
Deep sequencing
114 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 387473286-387473345 [-]
sense
ENSMODT00000005267 ; TRPS1-201; intron 5
Database links

Mature sequence mdo-miR-7285-5p

Accession MIMAT0028546
Sequence

1 - 

agaggaaccccugauuuauuugg

 - 23

Get sequence
Deep sequencing109 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7285-3p

Accession MIMAT0028547
Sequence

38 - 

aagcaagucagcgguuccccuua

 - 60

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).