Stem-loop sequence mdo-mir-7262b

AccessionMI0023790 (change log)
DescriptionMonodelphis domestica miR-7262b stem-loop
Stem-loop
   --        aa  g        a auua 
5'   aaaagucu  gu caguuuua g    u
     ||||||||  || |||||||| |     
3'   uuuucgga  ca gucaaaau c    c
   gg        ac  g        c gaaa 
Get sequence
Deep sequencing
2653 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 44490336-44490393 [-]
sense
Database links

Mature sequence mdo-miR-7262b-5p

Accession MIMAT0028544
Sequence

1 - 

aaaagucuaagugcaguuuua

 - 21

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7262b-3p

Accession MIMAT0028545
Sequence

38 - 

aaacuggaccaaggcuuuugg

 - 58

Get sequence
Deep sequencing2649 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).