Stem-loop sequence mdo-mir-7284

AccessionMI0023789 (change log)
DescriptionMonodelphis domestica miR-7284 stem-loop
Stem-loop
   --   a                 -ua   au 
5'   acu gcguauaguugguaauu   uaa  g
     ||| |||||||||||||||||   |||  u
3'   uga cgcauaucaaccauuag   auu  u
   cg   c                 uca   cu 
Get sequence
Deep sequencing
3066 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 21758873-21758934 [-]
sense
ENSMODT00000000792 ; LRRC7-201; intron 1
Clustered miRNAs
< 10kb from mdo-mir-7284
mdo-mir-7284bchr2: 21758875-21758936 [+]
mdo-mir-7284chr2: 21758873-21758934 [-]
Database links

Mature sequence mdo-miR-7284-5p

Accession MIMAT0028542
Sequence

1 - 

acuagcguauaguugguaauu

 - 21

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7284-3p

Accession MIMAT0028543
Sequence

42 - 

uuaccaacuauacgccagugc

 - 62

Get sequence
Deep sequencing3039 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).