Stem-loop sequence mdo-mir-7283

AccessionMI0023788 (change log)
DescriptionMonodelphis domestica miR-7283 stem-loop
Stem-loop
   --c     -    ucc        ug  ggcau 
5'    augcc cccc   cuauggcu  cu     u
      ||||| ||||   ||||||||  ||      
3'    uacgg gggg   gauaccga  gg     c
   uga     u    --c        gu  ugaaa 
Get sequence
Deep sequencing
6824 reads, 25 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 646033023-646033085 [+]
sense
Database links

Mature sequence mdo-miR-7283-5p

Accession MIMAT0028540
Sequence

1 - 

caugccccccucccuauggcuug

 - 23

Get sequence
Deep sequencing6613 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7283-3p

Accession MIMAT0028541
Sequence

42 - 

agccauagcgggguggcauagu

 - 63

Get sequence
Deep sequencing210 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).