Stem-loop sequence mdo-mir-7282

AccessionMI0023787 (change log)
DescriptionMonodelphis domestica miR-7282 stem-loop
Stem-loop
   --a     ugu       ucuu     g 
5'    aauuc   cggcaac    uggag u
      |||||   |||||||    |||||  
3'    uuagg   gucguug    accuc u
   agg     --u       ---u     u 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 487885135-487885185 [+]
sense
ENSMODT00000006326 ; mdo-mir-7282-201; 3'UTR (exon 4)
Database links

Mature sequence mdo-miR-7282-5p

Accession MIMAT0028538
Sequence

1 - 

aaauucugucggcaacucuuugg

 - 23

Get sequence
Deep sequencing71 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7282-3p

Accession MIMAT0028539
Sequence

34 - 

auguugcuguggauugga

 - 51

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).