Stem-loop sequence mdo-mir-7281

AccessionMI0023786 (change log)
DescriptionMonodelphis domestica miR-7281 stem-loop
Stem-loop
   --        u   a       ug    aa 
5'   uaauaggc cuu guaaaug  uguu  a
     |||||||| ||| |||||||  ||||   
3'   auuauccg gaa uauuuac  acaa  u
   gu        u   g       ca    gu 
Get sequence
Deep sequencing
4099 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 37484368-37484427 [+]
sense
ENSMODT00000004772 ; USP24-201; intron 60
Database links

Mature sequence mdo-miR-7281-5p

Accession MIMAT0028536
Sequence

1 - 

uaauaggcucuuaguaaaugug

 - 22

Get sequence
Deep sequencing4088 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7281-3p

Accession MIMAT0028537
Sequence

39 - 

cauuuaugaagugccuauuaug

 - 60

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).