Stem-loop sequence mdo-mir-7280

AccessionMI0023785 (change log)
DescriptionMonodelphis domestica miR-7280 stem-loop
Stem-loop
   --ca        ca   a  ---   ga  cc 
5'     gcagagag  cgg gc   cgc  gc  a
       ||||||||  ||| ||   |||  ||  g
3'     cgucucuc  gcc cg   gcg  cg  a
   ccac        aa   c  uac   -a  ac 
Get sequence
Deep sequencing
41682 reads, 500 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 339814390-339814450 [+]
sense
ENSMODT00000023308 ; CYB5R4-201; intron 10
Database links

Mature sequence mdo-miR-7280-5p

Accession MIMAT0028534
Sequence

1 - 

cagcagagagcacggagccgcga

 - 23

Get sequence
Deep sequencing1511 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7280-3p

Accession MIMAT0028535
Sequence

39 - 

caugccccgaacucucugccacc

 - 61

Get sequence
Deep sequencing40169 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).