Stem-loop sequence mdo-mir-7279

AccessionMI0023784 (change log)
DescriptionMonodelphis domestica miR-7279 stem-loop
Stem-loop
   uca  --u   cuuu  u       u   ua 
5'    gc   ggg    gg guuggag cau  a
      ||   |||    || ||||||| |||  u
3'    cg   ccc    uc caaucuc gua  g
   -ga  ucu   ---u  u       u   ca 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 278258771-278258829 [+]
sense
ENSMODT00000016971 ; ZFAND3-201; intron 5
antisense
ENSMODT00000016963 ; BTBD9-201; intron 11
Database links

Mature sequence mdo-miR-7279-5p

Accession MIMAT0028532
Sequence

1 - 

ucagcugggcuuugguguuggaguca

 - 26

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7279-3p

Accession MIMAT0028533
Sequence

38 - 

ucucuaacucuucccucugcag

 - 59

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).