Stem-loop sequence mdo-mir-219-2

AccessionMI0023783 (change log)
DescriptionMonodelphis domestica miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   --u   u     a  g         -u   u 
5'    gau gucca ac caauucucg  ggc c
      ||| ||||| || |||||||||  |||  
3'    cua caggu ug guugagagc  ccg c
   gcc   -     c  g         uc   g 
Get sequence
Deep sequencing
6940 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 270698645-270698704 [+]
sense
ENSMODT00000040304 ; mdo-mir-219-2-201; exon 1
Database links

Mature sequence mdo-miR-219-5p

Accession MIMAT0004134
Sequence

1 - 

ugauuguccaaacgcaauucu

 - 21

Get sequence
Deep sequencing13938 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-219-2-3p

Accession MIMAT0031109
Sequence

41 - 

aguugggucuggacaucccg

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).