Stem-loop sequence mdo-mir-7278

AccessionMI0023782 (change log)
DescriptionMonodelphis domestica miR-7278 stem-loop
Stem-loop
   --u       c  -  c         u a a 
5'    ugaagga ug gg aggugaugg g c g
      ||||||| || || ||||||||| | | c
3'    acuuccu ac cu uccacugcc c g c
   ucu       a  a  u         c c a 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 266773413-266773474 [+]
sense
Database links

Mature sequence mdo-miR-7278-5p

Accession MIMAT0028530
Sequence

1 - 

uugaaggacugggcaggugau

 - 21

Get sequence
Deep sequencing225 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7278-3p

Accession MIMAT0028531
Sequence

41 - 

caccuuucacaauccuucaucu

 - 62

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).