Stem-loop sequence mdo-mir-7277

AccessionMI0023781 (change log)
DescriptionMonodelphis domestica miR-7277 stem-loop
Stem-loop
   --        c    gc      cu   ug    c 
5'   uccugguc ucuc  ugcccc  gcc  agca g
     |||||||| ||||  ||||||  |||  ||||  
3'   gggaccag agag  acgggg  cgg  ucgu u
   ag        u    --      --   --    c 
Get sequence
Deep sequencing
1307 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 48274735-48274798 [-]
sense
ENSMODT00000020470 ; FAM13C-201; intron 12
Database links

Mature sequence mdo-miR-7277-5p

Accession MIMAT0028528
Sequence

1 - 

uccugguccucucgcugcccccugcc

 - 26

Get sequence
Deep sequencing312 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7277-3p

Accession MIMAT0028529
Sequence

43 - 

cggggcagagaugaccagggga

 - 64

Get sequence
Deep sequencing995 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).