Stem-loop sequence mdo-mir-7276

AccessionMI0023780 (change log)
DescriptionMonodelphis domestica miR-7276 stem-loop
Stem-loop
   --c    c    a   ca   ga  -u      c  ca    g 
5'    ccuu cuuc cug  ggu  gc  gcggag ug  gcgg g
      |||| |||| |||  |||  ||  |||||| ||  ||||  
3'    ggaa gagg gac  ccg  ug  cgccuu ac  cgcc c
   gcu    c    -   --   aa  cc      -  cc    c 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 253492944-253493024 [+]
intergenic
Database links

Mature sequence mdo-miR-7276-5p

Accession MIMAT0028526
Sequence

1 - 

cccuuccuucacugcagguga

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7276-3p

Accession MIMAT0028527
Sequence

64 - 

gcccagggagcaaggucg

 - 81

Get sequence
Deep sequencing46 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).