Stem-loop sequence mdo-mir-7275

AccessionMI0023779 (change log)
DescriptionMonodelphis domestica miR-7275 stem-loop
Stem-loop
   --- uu      c ga         a   g 
5'    c  ucaccu u  auauucacu agu u
      |  |||||| |  ||||||||| |||  
3'    g  aguggg a  uguaaguga uua u
   agg uu      u ag         g   u 
Get sequence
Deep sequencing
33707 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 233748731-233748789 [+]
sense
ENSMODT00000003177 ; AATK-201; intron 1
Database links

Mature sequence mdo-miR-7275-5p

Accession MIMAT0028524
Sequence

1 - 

cuuucaccucugaauauucacu

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7275-3p

Accession MIMAT0028525
Sequence

37 - 

ugaaugugaaugggugauuggga

 - 59

Get sequence
Deep sequencing33704 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).