Stem-loop sequence mdo-mir-7274

AccessionMI0023778 (change log)
DescriptionMonodelphis domestica miR-7274 stem-loop
Stem-loop
      --a     -c   cc        uuccu 
5' ccc   agaga  agg  gagaguga     g
   |||   |||||  |||  ||||||||      
3' ggg   ucucu  ucc  uucucacu     a
      acg     uu   uu        ucccg 
Get sequence
Deep sequencing
124 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 214563885-214563945 [+]
sense
ENSMODT00000008997 ; HID1-201; 3'UTR (exon 18)
Database links

Mature sequence mdo-miR-7274-5p

Accession MIMAT0028522
Sequence

1 - 

cccaagagacaggccgagaguga

 - 23

Get sequence
Deep sequencing115 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7274-3p

Accession MIMAT0028523
Sequence

38 - 

acucuuuuccuuuucucugcaggg

 - 61

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).