Stem-loop sequence mdo-mir-7273

AccessionMI0023777 (change log)
DescriptionMonodelphis domestica miR-7273 stem-loop
Stem-loop
   --          c      ga     ucaug 
5'   caagcuaggc uggaua  agcac     u
     |||||||||| ||||||  |||||     a
3'   guuugauccg accuau  ucgug     u
   ua          u      --     uaaga 
Get sequence
Deep sequencing
345 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 19197025-19197085 [+]
sense
ENSMODT00000000588 ; NEGR1-201; intron 1
Database links

Mature sequence mdo-miR-7273-5p

Accession MIMAT0028520
Sequence

1 - 

caagcuaggccuggauagaagc

 - 22

Get sequence
Deep sequencing330 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7273-3p

Accession MIMAT0028521
Sequence

42 - 

uuauccaugccuaguuugau

 - 61

Get sequence
Deep sequencing15 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).